Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2694252..2694397 | Replicon | chromosome |
Accession | NZ_CP080091 | ||
Organism | Salmonella enterica strain SLR1_8245 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2694254..2694357 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2694252..2694397 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KZY40_RS13165 | 2689452..2689670 | - | 219 | WP_001524708.1 | hypothetical protein | - |
KZY40_RS23725 | 2689972..2690070 | - | 99 | WP_223151200.1 | hypothetical protein | - |
KZY40_RS13175 | 2690389..2692368 | - | 1980 | WP_001237395.1 | alkyl sulfatase dimerization domain-containing protein | - |
KZY40_RS13180 | 2692782..2693060 | + | 279 | WP_001575998.1 | excisionase | - |
KZY40_RS13185 | 2693035..2694114 | + | 1080 | WP_000087636.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 2694252..2694397 | + | 146 | - | - | Antitoxin |
- | 2694254..2694357 | - | 104 | - | - | Toxin |
KZY40_RS13190 | 2694497..2694850 | - | 354 | WP_000722370.1 | YebY family protein | - |
KZY40_RS13195 | 2694867..2695742 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
KZY40_RS13200 | 2695743..2696117 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
KZY40_RS13205 | 2696255..2696485 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
KZY40_RS13210 | 2696593..2697249 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
KZY40_RS13215 | 2697273..2697971 | + | 699 | WP_000944288.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 / sopE2 / sodCI | 2640353..2716267 | 75914 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T210727 NZ_CP080091:c2694357-2694254 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT210727 NZ_CP080091:2694252-2694397 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG