Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1756203..1756297 | Replicon | chromosome |
Accession | NC_005810 | ||
Organism | Yersinia pestis biovar Microtus str. 91001 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1756204..1756297 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1756203..1756297 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
YP_RS08365 | 1751396..1753474 | - | 2079 | WP_002211100.1 | flagellar biosynthesis protein FlhA | - |
YP_RS08370 | 1753474..1754634 | - | 1161 | WP_002211099.1 | flagellar type III secretion system protein FlhB | - |
YP_RS08375 | 1755166..1755624 | + | 459 | WP_002211098.1 | hypothetical protein | - |
YP_RS08380 | 1755618..1755944 | + | 327 | WP_002211097.1 | DUF1493 family protein | - |
- | 1756203..1756297 | + | 95 | - | - | Antitoxin |
- | 1756204..1756297 | - | 94 | - | - | Toxin |
YP_RS08390 | 1756467..1756808 | - | 342 | WP_002211095.1 | YebY family protein | - |
YP_RS08395 | 1756905..1757789 | - | 885 | WP_002211094.1 | copper homeostasis membrane protein CopD | - |
YP_RS08400 | 1757792..1758178 | - | 387 | WP_002211093.1 | CopC domain-containing protein YobA | - |
YP_RS08405 | 1758410..1758577 | + | 168 | WP_161994017.1 | hypothetical protein | - |
YP_RS08410 | 1758610..1759119 | - | 510 | WP_002211092.1 | non-heme ferritin | - |
YP_RS08415 | 1759520..1759750 | + | 231 | WP_002211091.1 | DNA polymerase III subunit theta | - |
YP_RS08420 | 1759810..1760760 | - | 951 | WP_002211090.1 | prolyl aminopeptidase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 94 bp
>T21041 NC_005810:c1756297-1756204 [Yersinia pestis biovar Microtus str. 91001]
TAAGCCTACATTAATACCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATCAGGAATCGTA
TTCGGTCTTTTTTT
TAAGCCTACATTAATACCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATCAGGAATCGTA
TTCGGTCTTTTTTT
Antitoxin
Download Length: 95 bp
>AT21041 NC_005810:1756203-1756297 [Yersinia pestis biovar Microtus str. 91001]
TAAAAAAAGACCGAATACGATTCCTGATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGT
ATTAATGTAGGCTTA
TAAAAAAAGACCGAATACGATTCCTGATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGT
ATTAATGTAGGCTTA