Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1872513..1872658 | Replicon | chromosome |
Accession | NZ_CP079781 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain T698-1 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1872549..1872651 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1872513..1872658 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KYY07_RS09140 (KYY07_09150) | 1867643..1869703 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
KYY07_RS09145 (KYY07_09155) | 1869707..1870366 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
KYY07_RS09150 (KYY07_09160) | 1870445..1870675 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
KYY07_RS09155 (KYY07_09165) | 1870788..1871162 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
KYY07_RS09160 (KYY07_09170) | 1871166..1872035 | + | 870 | WP_004189267.1 | copper homeostasis membrane protein CopD | - |
KYY07_RS09165 (KYY07_09175) | 1872052..1872390 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1872513..1872658 | - | 146 | - | - | Antitoxin |
- | 1872549..1872651 | + | 103 | - | - | Toxin |
KYY07_RS09170 (KYY07_09180) | 1873026..1873169 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
KYY07_RS09175 (KYY07_09185) | 1873274..1874242 | - | 969 | WP_241510502.1 | VirK/YbjX family protein | - |
KYY07_RS09180 (KYY07_09190) | 1874399..1875052 | + | 654 | WP_009484457.1 | protein-serine/threonine phosphatase | - |
KYY07_RS09185 (KYY07_09195) | 1875049..1875240 | - | 192 | WP_002911395.1 | YebW family protein | - |
KYY07_RS09190 (KYY07_09200) | 1875338..1875577 | - | 240 | WP_002911393.1 | YebV family protein | - |
KYY07_RS09195 (KYY07_09205) | 1875693..1877126 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T210086 NZ_CP079781:1872549-1872651 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT210086 NZ_CP079781:c1872658-1872513 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT