Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2048469..2048614 | Replicon | chromosome |
Accession | NZ_CP079692 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain WRC31_S468MPCH |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2048505..2048607 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2048469..2048614 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KW564_RS10030 | 2043599..2045659 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
KW564_RS10035 | 2045663..2046322 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
KW564_RS10040 | 2046401..2046631 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
KW564_RS10045 | 2046744..2047118 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
KW564_RS10050 | 2047122..2047991 | + | 870 | WP_004175431.1 | copper homeostasis membrane protein CopD | - |
KW564_RS10055 | 2048008..2048346 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2048469..2048614 | - | 146 | - | - | Antitoxin |
- | 2048505..2048607 | + | 103 | - | - | Toxin |
KW564_RS10060 | 2048983..2049126 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
KW564_RS10065 | 2049231..2050199 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
KW564_RS10070 | 2050356..2051009 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
KW564_RS10075 | 2051006..2051197 | - | 192 | WP_002911395.1 | YebW family protein | - |
KW564_RS10080 | 2051295..2051534 | - | 240 | WP_002911393.1 | YebV family protein | - |
KW564_RS10085 | 2051650..2053083 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T209718 NZ_CP079692:2048505-2048607 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT209718 NZ_CP079692:c2048614-2048469 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT