Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2012441..2012586 | Replicon | chromosome |
Accession | NZ_CP079683 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain WRC30_AI1547MPCH |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2012477..2012579 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2012441..2012586 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KW563_RS09785 | 2007571..2009631 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
KW563_RS09790 | 2009635..2010294 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
KW563_RS09795 | 2010373..2010603 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
KW563_RS09800 | 2010716..2011090 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
KW563_RS09805 | 2011094..2011963 | + | 870 | WP_004175431.1 | copper homeostasis membrane protein CopD | - |
KW563_RS09810 | 2011980..2012318 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2012441..2012586 | - | 146 | - | - | Antitoxin |
- | 2012477..2012579 | + | 103 | - | - | Toxin |
KW563_RS09815 | 2012955..2013098 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
KW563_RS09820 | 2013203..2014171 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
KW563_RS09825 | 2014328..2014981 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
KW563_RS09830 | 2014978..2015169 | - | 192 | WP_002911395.1 | YebW family protein | - |
KW563_RS09835 | 2015267..2015506 | - | 240 | WP_002911393.1 | YebV family protein | - |
KW563_RS09840 | 2015622..2017055 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1941878..2029983 | 88105 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T209699 NZ_CP079683:2012477-2012579 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT209699 NZ_CP079683:c2012586-2012441 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT