Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 98994..99139 | Replicon | chromosome |
Accession | NZ_CP079673 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain WRC29_CMC309MPCH |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 99001..99103 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 98994..99139 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KW562_RS00455 | 94525..95958 | + | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
KW562_RS00460 | 96074..96313 | + | 240 | WP_002911393.1 | YebV family protein | - |
KW562_RS00465 | 96411..96602 | + | 192 | WP_002911395.1 | YebW family protein | - |
KW562_RS00470 | 96599..97252 | - | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
KW562_RS00475 | 97409..98377 | + | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
KW562_RS00480 | 98482..98625 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
- | 98994..99139 | + | 146 | - | - | Antitoxin |
- | 99001..99103 | - | 103 | - | - | Toxin |
KW562_RS00485 | 99262..99600 | - | 339 | WP_002911404.1 | YebY family protein | - |
KW562_RS00490 | 99617..100486 | - | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
KW562_RS00495 | 100490..100864 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
KW562_RS00500 | 100977..101207 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
KW562_RS00505 | 101286..101945 | + | 660 | WP_043906809.1 | exodeoxyribonuclease X | - |
KW562_RS00510 | 101949..104009 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T209679 NZ_CP079673:c99103-99001 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT209679 NZ_CP079673:98994-99139 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT