Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 4078845..4078990 | Replicon | chromosome |
Accession | NZ_CP079645 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain WRC24_S468MC |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 4078852..4078954 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 4078845..4078990 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KW559_RS20055 | 4074376..4075809 | + | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
KW559_RS20060 | 4075925..4076164 | + | 240 | WP_002911393.1 | YebV family protein | - |
KW559_RS20065 | 4076262..4076453 | + | 192 | WP_002911395.1 | YebW family protein | - |
KW559_RS20070 | 4076450..4077103 | - | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
KW559_RS20075 | 4077260..4078228 | + | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
KW559_RS20080 | 4078333..4078476 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
- | 4078845..4078990 | + | 146 | - | - | Antitoxin |
- | 4078852..4078954 | - | 103 | - | - | Toxin |
KW559_RS20085 | 4079113..4079451 | - | 339 | WP_002911404.1 | YebY family protein | - |
KW559_RS20090 | 4079468..4080337 | - | 870 | WP_004175431.1 | copper homeostasis membrane protein CopD | - |
KW559_RS20095 | 4080341..4080715 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
KW559_RS20100 | 4080828..4081058 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
KW559_RS20105 | 4081137..4081796 | + | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
KW559_RS20110 | 4081800..4083860 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 4061448..4152281 | 90833 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T209624 NZ_CP079645:c4078954-4078852 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT209624 NZ_CP079645:4078845-4078990 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT