Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2017267..2017412 | Replicon | chromosome |
Accession | NZ_CP079642 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain WRC22_AI1646MC |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2017303..2017405 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2017267..2017412 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KW558_RS09820 | 2012397..2014457 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
KW558_RS09825 | 2014461..2015120 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
KW558_RS09830 | 2015199..2015429 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
KW558_RS09835 | 2015542..2015916 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
KW558_RS09840 | 2015920..2016789 | + | 870 | WP_004175431.1 | copper homeostasis membrane protein CopD | - |
KW558_RS09845 | 2016806..2017144 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2017267..2017412 | - | 146 | - | - | Antitoxin |
- | 2017303..2017405 | + | 103 | - | - | Toxin |
KW558_RS09850 | 2017781..2017924 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
KW558_RS09855 | 2018029..2018997 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
KW558_RS09860 | 2019154..2019807 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
KW558_RS09865 | 2019804..2019995 | - | 192 | WP_002911395.1 | YebW family protein | - |
KW558_RS09870 | 2020093..2020332 | - | 240 | WP_002911393.1 | YebV family protein | - |
KW558_RS09875 | 2020448..2021881 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T209603 NZ_CP079642:2017303-2017405 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT209603 NZ_CP079642:c2017412-2017267 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT