Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2138931..2139076 | Replicon | chromosome |
Accession | NZ_CP079629 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain WRC18_CMC307MC |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2138967..2139069 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2138931..2139076 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KW554_RS10665 | 2134061..2136121 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
KW554_RS10670 | 2136125..2136784 | - | 660 | WP_043906809.1 | exodeoxyribonuclease X | - |
KW554_RS10675 | 2136863..2137093 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
KW554_RS10680 | 2137206..2137580 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
KW554_RS10685 | 2137584..2138453 | + | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
KW554_RS10690 | 2138470..2138808 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2138931..2139076 | - | 146 | - | - | Antitoxin |
- | 2138967..2139069 | + | 103 | - | - | Toxin |
KW554_RS10695 | 2139445..2139588 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
KW554_RS10700 | 2139693..2140661 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
KW554_RS10705 | 2140818..2141471 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
KW554_RS10710 | 2141468..2141659 | - | 192 | WP_002911395.1 | YebW family protein | - |
KW554_RS10715 | 2141757..2141996 | - | 240 | WP_002911393.1 | YebV family protein | - |
KW554_RS10720 | 2142112..2143545 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T209548 NZ_CP079629:2138967-2139069 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT209548 NZ_CP079629:c2139076-2138931 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT