Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2153471..2153616 | Replicon | chromosome |
Accession | NZ_CP079624 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain WRC17_CMC307PC |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2153507..2153609 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2153471..2153616 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KW552_RS10720 | 2148601..2150661 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
KW552_RS10725 | 2150665..2151324 | - | 660 | WP_043906809.1 | exodeoxyribonuclease X | - |
KW552_RS10730 | 2151403..2151633 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
KW552_RS10735 | 2151746..2152120 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
KW552_RS10740 | 2152124..2152993 | + | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
KW552_RS10745 | 2153010..2153348 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2153471..2153616 | - | 146 | - | - | Antitoxin |
- | 2153507..2153609 | + | 103 | - | - | Toxin |
KW552_RS10750 | 2153985..2154128 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
KW552_RS10755 | 2154233..2155201 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
KW552_RS10760 | 2155358..2156011 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
KW552_RS10765 | 2156008..2156199 | - | 192 | WP_002911395.1 | YebW family protein | - |
KW552_RS10770 | 2156297..2156536 | - | 240 | WP_002911393.1 | YebV family protein | - |
KW552_RS10775 | 2156652..2158085 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2080416..2171789 | 91373 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T209528 NZ_CP079624:2153507-2153609 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT209528 NZ_CP079624:c2153616-2153471 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT