Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1621775..1621920 | Replicon | chromosome |
Accession | NZ_CP079599 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain WRC10_CMC309MC |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1621782..1621884 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1621775..1621920 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KWY78_RS07885 | 1617306..1618739 | + | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
KWY78_RS07890 | 1618855..1619094 | + | 240 | WP_002911393.1 | YebV family protein | - |
KWY78_RS07895 | 1619192..1619383 | + | 192 | WP_002911395.1 | YebW family protein | - |
KWY78_RS07900 | 1619380..1620033 | - | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
KWY78_RS07905 | 1620190..1621158 | + | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
KWY78_RS07910 | 1621263..1621406 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
- | 1621775..1621920 | + | 146 | - | - | Antitoxin |
- | 1621782..1621884 | - | 103 | - | - | Toxin |
KWY78_RS07915 | 1622043..1622381 | - | 339 | WP_002911404.1 | YebY family protein | - |
KWY78_RS07920 | 1622398..1623267 | - | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
KWY78_RS07925 | 1623271..1623645 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
KWY78_RS07930 | 1623758..1623988 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
KWY78_RS07935 | 1624067..1624726 | + | 660 | WP_043906809.1 | exodeoxyribonuclease X | - |
KWY78_RS07940 | 1624730..1626790 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T209473 NZ_CP079599:c1621884-1621782 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT209473 NZ_CP079599:1621775-1621920 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT