Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2054560..2054705 | Replicon | chromosome |
Accession | NZ_CP079179 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain WRC13_AI2040PC |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2054596..2054698 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2054560..2054705 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KWY86_RS10005 | 2049690..2051750 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
KWY86_RS10010 | 2051754..2052413 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
KWY86_RS10015 | 2052492..2052722 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
KWY86_RS10020 | 2052835..2053209 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
KWY86_RS10025 | 2053213..2054082 | + | 870 | WP_004175431.1 | copper homeostasis membrane protein CopD | - |
KWY86_RS10030 | 2054099..2054437 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2054560..2054705 | - | 146 | - | - | Antitoxin |
- | 2054596..2054698 | + | 103 | - | - | Toxin |
KWY86_RS10035 | 2055074..2055217 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
KWY86_RS10040 | 2055322..2056290 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
KWY86_RS10045 | 2056447..2057100 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
KWY86_RS10050 | 2057097..2057288 | - | 192 | WP_002911395.1 | YebW family protein | - |
KWY86_RS10055 | 2057386..2057625 | - | 240 | WP_002911393.1 | YebV family protein | - |
KWY86_RS10060 | 2057741..2059174 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1982036..2073763 | 91727 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T209417 NZ_CP079179:2054596-2054698 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT209417 NZ_CP079179:c2054705-2054560 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT