Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 5264490..5264635 | Replicon | chromosome |
Accession | NZ_CP079138 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain WRC05_CMC387PC |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 5264526..5264628 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 5264490..5264635 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KWY70_RS25410 | 5259620..5261680 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
KWY70_RS25415 | 5261684..5262343 | - | 660 | WP_043906809.1 | exodeoxyribonuclease X | - |
KWY70_RS25420 | 5262422..5262652 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
KWY70_RS25425 | 5262765..5263139 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
KWY70_RS25430 | 5263143..5264012 | + | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
KWY70_RS25435 | 5264029..5264367 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 5264490..5264635 | - | 146 | - | - | Antitoxin |
- | 5264526..5264628 | + | 103 | - | - | Toxin |
KWY70_RS25440 | 5265004..5265147 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
KWY70_RS25445 | 5265252..5266220 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
KWY70_RS25450 | 5266377..5267030 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
KWY70_RS25455 | 5267027..5267218 | - | 192 | WP_002911395.1 | YebW family protein | - |
KWY70_RS25460 | 5267316..5267555 | - | 240 | WP_002911393.1 | YebV family protein | - |
KWY70_RS25465 | 5267671..5269104 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 5191435..5271861 | 80426 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T209303 NZ_CP079138:5264526-5264628 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT209303 NZ_CP079138:c5264635-5264490 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT