Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2702683..2702828 | Replicon | chromosome |
Accession | NZ_CP079131 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain WRC04_AI1235MC |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2702719..2702821 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2702683..2702828 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KWY69_RS13185 | 2697813..2699873 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
KWY69_RS13190 | 2699877..2700536 | - | 660 | WP_043906809.1 | exodeoxyribonuclease X | - |
KWY69_RS13195 | 2700615..2700845 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
KWY69_RS13200 | 2700958..2701332 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
KWY69_RS13205 | 2701336..2702205 | + | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
KWY69_RS13210 | 2702222..2702560 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2702683..2702828 | - | 146 | - | - | Antitoxin |
- | 2702719..2702821 | + | 103 | - | - | Toxin |
KWY69_RS13215 | 2703197..2703340 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
KWY69_RS13220 | 2703445..2704413 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
KWY69_RS13225 | 2704570..2705223 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
KWY69_RS13230 | 2705220..2705411 | - | 192 | WP_002911395.1 | YebW family protein | - |
KWY69_RS13235 | 2705509..2705748 | - | 240 | WP_002911393.1 | YebV family protein | - |
KWY69_RS13240 | 2705864..2707297 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2629628..2710054 | 80426 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T209279 NZ_CP079131:2702719-2702821 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT209279 NZ_CP079131:c2702828-2702683 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT