Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 436044..436189 | Replicon | chromosome |
Accession | NZ_CP077760 | ||
Organism | Salmonella enterica subsp. enterica serovar Gallinarum strain 07Q015 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 436046..436149 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 436044..436189 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KTV86_RS02240 | 432924..433754 | + | 831 | WP_001126031.1 | recombination protein RecT | - |
KTV86_RS02245 | 433801..433986 | + | 186 | WP_000280163.1 | DUF1187 family protein | - |
KTV86_RS02250 | 434085..434513 | + | 429 | WP_000743301.1 | hypothetical protein | - |
KTV86_RS02255 | 434574..434852 | + | 279 | WP_001575998.1 | excisionase | - |
KTV86_RS02260 | 434827..435906 | + | 1080 | WP_000087636.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 436044..436189 | + | 146 | - | - | Antitoxin |
- | 436046..436149 | - | 104 | - | - | Toxin |
KTV86_RS02265 | 436289..436642 | - | 354 | WP_000722370.1 | YebY family protein | - |
KTV86_RS02270 | 436659..437534 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
KTV86_RS02275 | 437535..437909 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
KTV86_RS02280 | 438047..438277 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
KTV86_RS02285 | 438385..439041 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
KTV86_RS02290 | 439065..439763 | + | 699 | WP_000944288.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 / sopE2 / sodCI | 364733..458059 | 93326 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T207726 NZ_CP077760:c436149-436046 [Salmonella enterica subsp. enterica serovar Gallinarum]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATCTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATCTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT207726 NZ_CP077760:436044-436189 [Salmonella enterica subsp. enterica serovar Gallinarum]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAGATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAGATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG