Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2004427..2004570 | Replicon | chromosome |
| Accession | NZ_CP077702 | ||
| Organism | Salmonella enterica subsp. enterica strain CFSAN058588 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2004465..2004568 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2004427..2004570 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| DAX60_RS09605 | 2000852..2001550 | - | 699 | WP_000944280.1 | exodeoxyribonuclease X | - |
| DAX60_RS09610 | 2001574..2002230 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| DAX60_RS09615 | 2002337..2002567 | - | 231 | WP_000856225.1 | DNA polymerase III subunit theta | - |
| DAX60_RS09620 | 2002705..2003079 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| DAX60_RS09625 | 2003080..2003955 | + | 876 | WP_001529229.1 | copper homeostasis membrane protein CopD | - |
| DAX60_RS09630 | 2003972..2004325 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2004427..2004570 | - | 144 | - | - | Antitoxin |
| - | 2004465..2004568 | + | 104 | - | - | Toxin |
| DAX60_RS09635 | 2004699..2005778 | - | 1080 | WP_001529245.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| DAX60_RS09640 | 2005811..2006959 | - | 1149 | Protein_1892 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| DAX60_RS09645 | 2006951..2007199 | + | 249 | Protein_1893 | glycoside hydrolase family 19 protein | - |
| DAX60_RS09650 | 2007196..2007729 | + | 534 | WP_001529209.1 | DUF2514 domain-containing protein | - |
| DAX60_RS09655 | 2007986..2008153 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| DAX60_RS09660 | 2008456..2008947 | + | 492 | WP_000348550.1 | DUF1441 family protein | - |
| DAX60_RS09665 | 2008934..2009501 | + | 568 | Protein_1897 | phage terminase large subunit family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 1982556..2038686 | 56130 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T207566 NZ_CP077702:2004465-2004568 [Salmonella enterica subsp. enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT207566 NZ_CP077702:c2004570-2004427 [Salmonella enterica subsp. enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
