Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2139269..2139414 | Replicon | chromosome |
| Accession | NZ_CP077693 | ||
| Organism | Salmonella enterica subsp. enterica strain CFSAN058605 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2139309..2139412 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2139269..2139414 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| DAY14_RS10300 | 2135695..2136393 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| DAY14_RS10305 | 2136417..2137073 | - | 657 | WP_021294109.1 | carbon-nitrogen hydrolase family protein | - |
| DAY14_RS10310 | 2137181..2137411 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| DAY14_RS10315 | 2137549..2137923 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| DAY14_RS10320 | 2137924..2138799 | + | 876 | WP_000979705.1 | copper homeostasis membrane protein CopD | - |
| DAY14_RS10325 | 2138816..2139169 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2139269..2139414 | - | 146 | - | - | Antitoxin |
| - | 2139309..2139412 | + | 104 | - | - | Toxin |
| DAY14_RS10330 | 2139542..2140619 | - | 1078 | Protein_2031 | tyrosine-type recombinase/integrase | - |
| DAY14_RS10335 | 2140652..2141803 | - | 1152 | Protein_2032 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| DAY14_RS10340 | 2141792..2141983 | + | 192 | Protein_2033 | glycoside hydrolase family 19 protein | - |
| DAY14_RS10345 | 2142037..2142570 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| DAY14_RS10350 | 2142827..2142994 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| DAY14_RS10355 | 2143059..2143247 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| DAY14_RS10360 | 2143302..2143562 | + | 261 | Protein_2037 | DUF1441 family protein | - |
| DAY14_RS25905 | 2143564..2143779 | + | 216 | Protein_2038 | shikimate transporter | - |
| DAY14_RS10365 | 2143789..2144076 | + | 288 | Protein_2039 | macro domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2133607..2179116 | 45509 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T207504 NZ_CP077693:2139309-2139412 [Salmonella enterica subsp. enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT207504 NZ_CP077693:c2139414-2139269 [Salmonella enterica subsp. enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG