Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1981121..1981266 | Replicon | chromosome |
| Accession | NZ_CP077670 | ||
| Organism | Salmonella enterica strain S90 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1981161..1981264 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1981121..1981266 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| KTP13_RS09490 | 1977547..1978245 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| KTP13_RS09495 | 1978269..1978925 | - | 657 | WP_023227121.1 | carbon-nitrogen hydrolase family protein | - |
| KTP13_RS09500 | 1979033..1979263 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| KTP13_RS09505 | 1979401..1979775 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| KTP13_RS09510 | 1979776..1980651 | + | 876 | WP_001579467.1 | copper homeostasis membrane protein CopD | - |
| KTP13_RS09515 | 1980668..1981021 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 1981121..1981266 | - | 146 | - | - | Antitoxin |
| - | 1981161..1981264 | + | 104 | - | - | Toxin |
| KTP13_RS09520 | 1981385..1982035 | - | 651 | Protein_1856 | tyrosine-type recombinase/integrase | - |
| KTP13_RS09525 | 1982305..1982511 | + | 207 | Protein_1857 | phage tail protein | - |
| KTP13_RS09530 | 1982596..1982838 | + | 243 | Protein_1858 | DUF4376 domain-containing protein | - |
| KTP13_RS09535 | 1982944..1983275 | + | 332 | Protein_1859 | DUF1353 domain-containing protein | - |
| KTP13_RS09540 | 1983324..1983433 | + | 110 | Protein_1860 | tail fiber assembly protein | - |
| KTP13_RS09545 | 1983524..1983709 | - | 186 | WP_071787785.1 | PagK family vesicle-borne virulence factor | - |
| KTP13_RS09550 | 1983961..1984149 | - | 189 | Protein_1862 | tail fiber assembly protein | - |
| KTP13_RS09555 | 1984145..1984915 | - | 771 | WP_000758583.1 | transporter substrate-binding domain-containing protein | - |
| KTP13_RS09560 | 1984978..1985082 | + | 105 | Protein_1864 | DUF4113 domain-containing protein | - |
| KTP13_RS09565 | 1985405..1985533 | + | 129 | Protein_1865 | helix-turn-helix domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 1975461..1997040 | 21579 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T207405 NZ_CP077670:1981161-1981264 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT207405 NZ_CP077670:c1981266-1981121 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
