Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1979912..1980056 | Replicon | chromosome |
Accession | NZ_CP075890 | ||
Organism | Klebsiella pneumoniae strain GR390 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1979948..1980050 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1979912..1980056 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
J4H96_RS09560 (J4H96_09560) | 1975042..1977102 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
J4H96_RS09565 (J4H96_09565) | 1977106..1977765 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
J4H96_RS09570 (J4H96_09570) | 1977844..1978074 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
J4H96_RS09575 (J4H96_09575) | 1978187..1978561 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
J4H96_RS09580 (J4H96_09580) | 1978565..1979434 | + | 870 | WP_020956678.1 | copper homeostasis membrane protein CopD | - |
J4H96_RS09585 (J4H96_09585) | 1979451..1979789 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1979912..1980056 | - | 145 | - | - | Antitoxin |
- | 1979948..1980050 | + | 103 | - | - | Toxin |
J4H96_RS09590 (J4H96_09590) | 1980183..1980464 | - | 282 | Protein_1876 | tyrosine-type recombinase/integrase | - |
J4H96_RS09595 (J4H96_09595) | 1980541..1981020 | + | 480 | WP_032419797.1 | lysis protein | - |
J4H96_RS28770 | 1981475..1981670 | + | 196 | Protein_1878 | DNA polymerase V | - |
J4H96_RS09600 (J4H96_09600) | 1981809..1982960 | + | 1152 | WP_099769915.1 | hypothetical protein | - |
J4H96_RS09605 (J4H96_09605) | 1982986..1983954 | - | 969 | WP_004099053.1 | IS5-like element IS903B family transposase | - |
J4H96_RS09610 (J4H96_09610) | 1983934..1984380 | + | 447 | WP_139937642.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1975075..2004486 | 29411 | |
- | flank | IS/Tn | - | - | 1982986..1983909 | 923 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T204475 NZ_CP075890:1979948-1980050 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 145 bp
>AT204475 NZ_CP075890:c1980056-1979912 [Klebsiella pneumoniae]
ACATATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
ACATATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT