Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2162454..2162599 | Replicon | chromosome |
Accession | NZ_CP075316 | ||
Organism | Klebsiella pneumoniae strain DD521 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2162490..2162592 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2162454..2162599 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KJA60_RS10420 | 2157584..2159644 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
KJA60_RS10425 | 2159648..2160307 | - | 660 | WP_020324964.1 | exodeoxyribonuclease X | - |
KJA60_RS10430 | 2160386..2160616 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
KJA60_RS10435 | 2160729..2161103 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
KJA60_RS10440 | 2161107..2161976 | + | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
KJA60_RS10445 | 2161993..2162331 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2162454..2162599 | - | 146 | - | - | Antitoxin |
- | 2162490..2162592 | + | 103 | - | - | Toxin |
KJA60_RS10450 | 2162968..2163111 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
KJA60_RS10455 | 2163216..2164184 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
KJA60_RS10460 | 2164341..2164994 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
KJA60_RS10465 | 2164991..2165182 | - | 192 | WP_002911395.1 | YebW family protein | - |
KJA60_RS10470 | 2165280..2165519 | - | 240 | WP_002911393.1 | YebV family protein | - |
KJA60_RS10475 | 2165635..2167068 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2155000..2179996 | 24996 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T203431 NZ_CP075316:2162490-2162592 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT203431 NZ_CP075316:c2162599-2162454 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT