Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1964249..1964392 | Replicon | chromosome |
| Accession | NZ_CP075174 | ||
| Organism | Salmonella enterica subsp. houtenae serovar 45:gz51:- strain 20-369 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1964287..1964390 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1964249..1964392 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| KI721_RS09400 | 1960674..1961372 | - | 699 | WP_000944275.1 | exodeoxyribonuclease X | - |
| KI721_RS09405 | 1961396..1962052 | - | 657 | WP_079812453.1 | carbon-nitrogen hydrolase family protein | - |
| KI721_RS09410 | 1962159..1962389 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| KI721_RS09415 | 1962527..1962901 | + | 375 | WP_001664129.1 | CopC domain-containing protein YobA | - |
| KI721_RS09420 | 1962902..1963777 | + | 876 | WP_079812452.1 | copper homeostasis membrane protein CopD | - |
| KI721_RS09425 | 1963794..1964144 | + | 351 | WP_000746717.1 | YebY family protein | - |
| - | 1964249..1964392 | - | 144 | - | - | Antitoxin |
| - | 1964287..1964390 | + | 104 | - | - | Toxin |
| KI721_RS09430 | 1964511..1964906 | - | 396 | Protein_1840 | tyrosine-type recombinase/integrase | - |
| KI721_RS09435 | 1965181..1965897 | + | 717 | WP_233679877.1 | T3SS effector NleG family protein | - |
| KI721_RS09440 | 1966056..1966340 | - | 285 | WP_079812445.1 | HigA family addiction module antitoxin | - |
| KI721_RS09445 | 1966340..1966618 | - | 279 | WP_000597305.1 | type II toxin-antitoxin system RelE/ParE family toxin | - |
| KI721_RS09450 | 1966870..1967130 | + | 261 | WP_079812444.1 | hypothetical protein | - |
| KI721_RS09455 | 1967201..1967884 | - | 684 | WP_079812443.1 | PipA/GogA/GtgA family type III secretion system effector | - |
| KI721_RS09460 | 1968309..1968995 | + | 687 | WP_233679878.1 | hypothetical protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 1932493..1969576 | 37083 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T203335 NZ_CP075174:1964287-1964390 [Salmonella enterica subsp. houtenae serovar 45:g,z51:-]
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT203335 NZ_CP075174:c1964392-1964249 [Salmonella enterica subsp. houtenae serovar 45:g,z51:-]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
