Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2039015..2039158 | Replicon | chromosome |
| Accession | NZ_CP075138 | ||
| Organism | Salmonella enterica strain CFSAN044875 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2039053..2039156 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2039015..2039158 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| A7R97_RS09905 | 2035439..2036137 | - | 699 | WP_000944279.1 | exodeoxyribonuclease X | - |
| A7R97_RS09910 | 2036161..2036817 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| A7R97_RS09915 | 2036925..2037155 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| A7R97_RS09920 | 2037293..2037667 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| A7R97_RS09925 | 2037668..2038543 | + | 876 | WP_001623761.1 | copper homeostasis membrane protein CopD | - |
| A7R97_RS09930 | 2038560..2038913 | + | 354 | WP_023227990.1 | YebY family protein | - |
| - | 2039015..2039158 | - | 144 | - | - | Antitoxin |
| - | 2039053..2039156 | + | 104 | - | - | Toxin |
| A7R97_RS09935 | 2039296..2040375 | - | 1080 | WP_001623770.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| A7R97_RS09940 | 2040408..2041559 | - | 1152 | Protein_1953 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| A7R97_RS09945 | 2041548..2041739 | + | 192 | Protein_1954 | glycoside hydrolase family 19 protein | - |
| A7R97_RS09950 | 2041793..2042326 | + | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
| A7R97_RS09955 | 2042583..2042750 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| A7R97_RS09960 | 2042815..2043003 | - | 189 | WP_001532317.1 | hypothetical protein | - |
| A7R97_RS09965 | 2043058..2043549 | + | 492 | WP_001623776.1 | DUF1441 family protein | - |
| A7R97_RS09970 | 2043536..2044103 | + | 568 | Protein_1959 | phage terminase large subunit family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2033353..2074057 | 40704 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T203240 NZ_CP075138:2039053-2039156 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT203240 NZ_CP075138:c2039158-2039015 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
