Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2015494..2015648 | Replicon | chromosome |
| Accession | NZ_CP075127 | ||
| Organism | Salmonella enterica strain CFSAN044925 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2015532..2015635 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2015494..2015648 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| A7S47_RS09630 | 2011918..2012616 | - | 699 | WP_000944278.1 | exodeoxyribonuclease X | - |
| A7S47_RS09635 | 2012640..2013296 | - | 657 | WP_001524390.1 | carbon-nitrogen hydrolase family protein | - |
| A7S47_RS09640 | 2013404..2013634 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| A7S47_RS09645 | 2013772..2014146 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| A7S47_RS09650 | 2014147..2015022 | + | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| A7S47_RS09655 | 2015039..2015392 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2015494..2015648 | - | 155 | - | - | Antitoxin |
| - | 2015532..2015635 | + | 104 | - | - | Toxin |
| A7S47_RS09660 | 2015766..2016845 | - | 1080 | WP_001525019.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| A7S47_RS09665 | 2016878..2018029 | - | 1152 | Protein_1895 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| A7S47_RS09670 | 2018018..2018209 | + | 192 | Protein_1896 | glycoside hydrolase family 19 protein | - |
| A7S47_RS09675 | 2018263..2018796 | + | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
| A7S47_RS09680 | 2019053..2019220 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| A7S47_RS09685 | 2019285..2019473 | - | 189 | WP_001525026.1 | hypothetical protein | - |
| A7S47_RS09690 | 2019528..2020019 | + | 492 | WP_001525042.1 | DUF1441 family protein | - |
| A7S47_RS09695 | 2020006..2020573 | + | 568 | Protein_1901 | phage terminase large subunit family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 1993623..2051198 | 57575 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T203101 NZ_CP075127:2015532-2015635 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 155 bp
>AT203101 NZ_CP075127:c2015648-2015494 [Salmonella enterica]
TTTTAATCTAAATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGC
TAAAAGTTGGCATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
TTTTAATCTAAATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGC
TAAAAGTTGGCATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG