Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2686913..2687058 | Replicon | chromosome |
Accession | NZ_CP075122 | ||
Organism | Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN051827 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2686915..2687018 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2686913..2687058 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
BCA48_RS13085 | 2682113..2682331 | - | 219 | WP_001524708.1 | hypothetical protein | - |
BCA48_RS23405 | 2682633..2682731 | - | 99 | WP_223151200.1 | hypothetical protein | - |
BCA48_RS13095 | 2683050..2685029 | - | 1980 | WP_001237395.1 | alkyl sulfatase dimerization domain-containing protein | - |
BCA48_RS13100 | 2685443..2685721 | + | 279 | WP_001575998.1 | excisionase | - |
BCA48_RS13105 | 2685696..2686775 | + | 1080 | WP_000087636.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 2686913..2687058 | + | 146 | - | - | Antitoxin |
- | 2686915..2687018 | - | 104 | - | - | Toxin |
BCA48_RS13110 | 2687158..2687511 | - | 354 | WP_000722370.1 | YebY family protein | - |
BCA48_RS13115 | 2687528..2688403 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
BCA48_RS13120 | 2688404..2688778 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
BCA48_RS13125 | 2688916..2689146 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
BCA48_RS13130 | 2689254..2689910 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
BCA48_RS13135 | 2689934..2690632 | + | 699 | WP_000944288.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 / sodCI | 2650885..2692720 | 41835 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T203058 NZ_CP075122:c2687018-2686915 [Salmonella enterica subsp. enterica serovar Enteritidis]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT203058 NZ_CP075122:2686913-2687058 [Salmonella enterica subsp. enterica serovar Enteritidis]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG