Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1925100..1925243 | Replicon | chromosome |
| Accession | NZ_CP075115 | ||
| Organism | Salmonella enterica subsp. enterica serovar Eastbourne strain CFSAN059883 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1925138..1925241 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1925100..1925243 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| CCO38_RS09160 | 1921524..1922222 | - | 699 | WP_000944280.1 | exodeoxyribonuclease X | - |
| CCO38_RS09165 | 1922246..1922902 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| CCO38_RS09170 | 1923010..1923240 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| CCO38_RS09175 | 1923378..1923752 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| CCO38_RS09180 | 1923753..1924628 | + | 876 | WP_000979695.1 | copper homeostasis membrane protein CopD | - |
| CCO38_RS09185 | 1924645..1924998 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 1925100..1925243 | - | 144 | - | - | Antitoxin |
| - | 1925138..1925241 | + | 104 | - | - | Toxin |
| CCO38_RS09190 | 1925372..1926295 | - | 924 | Protein_1798 | tyrosine-type recombinase/integrase | - |
| CCO38_RS21950 | 1926559..1927017 | - | 459 | Protein_1799 | DNA breaking-rejoining protein | - |
| CCO38_RS09200 | 1927009..1927257 | + | 249 | Protein_1800 | glycoside hydrolase family 19 protein | - |
| CCO38_RS09205 | 1927254..1927787 | + | 534 | WP_001529209.1 | DUF2514 domain-containing protein | - |
| CCO38_RS09210 | 1928044..1928211 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| CCO38_RS09215 | 1928514..1929005 | + | 492 | WP_023233022.1 | DUF1441 family protein | - |
| CCO38_RS09220 | 1928992..1929559 | + | 568 | Protein_1804 | phage terminase large subunit family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 1903228..1958414 | 55186 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T202956 NZ_CP075115:1925138-1925241 [Salmonella enterica subsp. enterica serovar Eastbourne]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT202956 NZ_CP075115:c1925243-1925100 [Salmonella enterica subsp. enterica serovar Eastbourne]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
