Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2014660..2014805 | Replicon | chromosome |
Accession | NZ_CP075112 | ||
Organism | Salmonella enterica subsp. enterica serovar Corvallis strain CFSAN059903 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2014700..2014803 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2014660..2014805 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
CCO42_RS09545 | 2011086..2011784 | - | 699 | WP_000944285.1 | exodeoxyribonuclease X | - |
CCO42_RS09550 | 2011808..2012464 | - | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
CCO42_RS09555 | 2012572..2012802 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
CCO42_RS09560 | 2012940..2013314 | + | 375 | WP_000168395.1 | CopC domain-containing protein YobA | - |
CCO42_RS09565 | 2013315..2014190 | + | 876 | WP_094963915.1 | copper homeostasis membrane protein CopD | - |
CCO42_RS09570 | 2014207..2014560 | + | 354 | WP_000722368.1 | YebY family protein | - |
- | 2014660..2014805 | - | 146 | - | - | Antitoxin |
- | 2014700..2014803 | + | 104 | - | - | Toxin |
CCO42_RS09575 | 2014934..2015281 | - | 348 | Protein_1880 | tyrosine-type recombinase/integrase | - |
CCO42_RS23000 | 2015293..2015376 | + | 84 | Protein_1881 | phage tail protein | - |
CCO42_RS09585 | 2015548..2017908 | + | 2361 | WP_063809182.1 | type III secretion system effector E3 ubiquitin transferase SspH2 | - |
CCO42_RS09590 | 2018010..2018552 | + | 543 | Protein_1883 | transposase | - |
CCO42_RS09595 | 2018698..2018838 | - | 141 | WP_031607419.1 | hypothetical protein | - |
CCO42_RS09600 | 2019007..2019273 | - | 267 | WP_077950928.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | flank | IS/Tn | - | - | 2017938..2018552 | 614 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T202911 NZ_CP075112:2014700-2014803 [Salmonella enterica subsp. enterica serovar Corvallis]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT202911 NZ_CP075112:c2014805-2014660 [Salmonella enterica subsp. enterica serovar Corvallis]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG