Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1993172..1993315 | Replicon | chromosome |
Accession | NZ_CP075110 | ||
Organism | Salmonella enterica strain CFSAN060804 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1993210..1993313 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1993172..1993315 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
CIC27_RS09595 | 1989595..1990293 | - | 699 | WP_000944280.1 | exodeoxyribonuclease X | - |
CIC27_RS09600 | 1990317..1990973 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
CIC27_RS09605 | 1991081..1991311 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
CIC27_RS09610 | 1991449..1991823 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
CIC27_RS09615 | 1991824..1992699 | + | 876 | WP_000979695.1 | copper homeostasis membrane protein CopD | - |
CIC27_RS09620 | 1992716..1993069 | + | 354 | WP_017441954.1 | YebY family protein | - |
- | 1993172..1993315 | - | 144 | - | - | Antitoxin |
- | 1993210..1993313 | + | 104 | - | - | Toxin |
CIC27_RS09625 | 1993444..1994523 | - | 1080 | WP_000087641.1 | phage integrase Arm DNA-binding domain-containing protein | - |
CIC27_RS09630 | 1994556..1995704 | - | 1149 | Protein_1897 | PD-(D/E)XK nuclease-like domain-containing protein | - |
CIC27_RS09635 | 1995696..1995944 | + | 249 | Protein_1898 | glycoside hydrolase family 19 protein | - |
CIC27_RS09640 | 1995941..1996473 | + | 533 | Protein_1899 | DUF2514 domain-containing protein | - |
CIC27_RS09645 | 1996730..1996897 | - | 168 | WP_000789530.1 | lytic enzyme | - |
CIC27_RS09650 | 1997200..1997691 | + | 492 | WP_000348547.1 | DUF1441 family protein | - |
CIC27_RS09655 | 1997678..1998245 | + | 568 | Protein_1902 | phage terminase large subunit family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 | 1971299..2026304 | 55005 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T202890 NZ_CP075110:1993210-1993313 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT202890 NZ_CP075110:c1993315-1993172 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG