Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2067212..2067357 | Replicon | chromosome |
| Accession | NZ_CP075106 | ||
| Organism | Salmonella enterica strain CFSAN064276 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2067252..2067355 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2067212..2067357 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| CBI76_RS09935 | 2063638..2064336 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| CBI76_RS09940 | 2064360..2065016 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| CBI76_RS09945 | 2065124..2065354 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| CBI76_RS09950 | 2065492..2065866 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| CBI76_RS09955 | 2065867..2066742 | + | 876 | WP_072101102.1 | copper homeostasis membrane protein CopD | - |
| CBI76_RS09960 | 2066759..2067112 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2067212..2067357 | - | 146 | - | - | Antitoxin |
| - | 2067252..2067355 | + | 104 | - | - | Toxin |
| CBI76_RS09965 | 2067484..2068563 | - | 1080 | WP_020438172.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| CBI76_RS09970 | 2068596..2069747 | - | 1152 | Protein_1954 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| CBI76_RS09975 | 2069736..2069927 | + | 192 | Protein_1955 | glycoside hydrolase family 19 protein | - |
| CBI76_RS09980 | 2069981..2070514 | + | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
| CBI76_RS09985 | 2070771..2070938 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| CBI76_RS09990 | 2071003..2071191 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| CBI76_RS09995 | 2071246..2071737 | + | 492 | WP_000348541.1 | DUF1441 family protein | - |
| CBI76_RS10000 | 2071724..2072291 | + | 568 | Protein_1960 | phage terminase large subunit family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2061552..2102270 | 40718 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T202806 NZ_CP075106:2067252-2067355 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT202806 NZ_CP075106:c2067357-2067212 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
