Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2070828..2070973 | Replicon | chromosome |
| Accession | NZ_CP074606 | ||
| Organism | Salmonella enterica subsp. enterica serovar Newport str. CFSAN000827 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2070868..2070971 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2070828..2070973 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| DLM99_RS10025 | 2067254..2067952 | - | 699 | WP_000944283.1 | exodeoxyribonuclease X | - |
| DLM99_RS10030 | 2067976..2068632 | - | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
| DLM99_RS10035 | 2068740..2068970 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| DLM99_RS10040 | 2069108..2069482 | + | 375 | WP_000168395.1 | CopC domain-containing protein YobA | - |
| DLM99_RS10045 | 2069483..2070358 | + | 876 | WP_000979686.1 | copper homeostasis membrane protein CopD | - |
| DLM99_RS10050 | 2070375..2070728 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2070828..2070973 | - | 146 | - | - | Antitoxin |
| - | 2070868..2070971 | + | 104 | - | - | Toxin |
| DLM99_RS10055 | 2071092..2072015 | - | 924 | Protein_1975 | tyrosine-type recombinase/integrase | - |
| DLM99_RS23925 | 2072279..2072740 | - | 462 | Protein_1976 | DNA breaking-rejoining protein | - |
| DLM99_RS10065 | 2072729..2072920 | + | 192 | Protein_1977 | glycoside hydrolase family 19 protein | - |
| DLM99_RS10070 | 2072974..2073507 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| DLM99_RS10075 | 2073764..2073931 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| DLM99_RS10080 | 2073996..2074184 | - | 189 | WP_001532317.1 | hypothetical protein | - |
| DLM99_RS10085 | 2074239..2074730 | + | 492 | WP_000348543.1 | DUF1441 family protein | - |
| DLM99_RS10090 | 2074717..2075284 | + | 568 | Protein_1982 | phage terminase large subunit family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2065168..2112480 | 47312 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T202519 NZ_CP074606:2070868-2070971 [Salmonella enterica subsp. enterica serovar Newport str.]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT202519 NZ_CP074606:c2070973-2070828 [Salmonella enterica subsp. enterica serovar Newport str.]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
