Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3359737..3359834 | Replicon | chromosome |
Accession | NZ_CP074147 | ||
Organism | Serratia sp. JSRIV001 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3359739..3359834 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3359737..3359825 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KGP17_RS15505 (KGP17_15440) | 3355017..3355475 | + | 459 | WP_223497899.1 | hypothetical protein | - |
KGP17_RS15510 (KGP17_15445) | 3355468..3355800 | + | 333 | WP_223497900.1 | hypothetical protein | - |
KGP17_RS15515 (KGP17_15450) | 3355800..3356630 | + | 831 | WP_223497901.1 | chromosome partitioning protein ParB | - |
KGP17_RS15520 (KGP17_15455) | 3356623..3358263 | + | 1641 | WP_223497902.1 | class I SAM-dependent methyltransferase | - |
KGP17_RS15525 (KGP17_15460) | 3358326..3358598 | + | 273 | WP_223497903.1 | excisionase | - |
KGP17_RS15530 (KGP17_15465) | 3358570..3359652 | + | 1083 | WP_223497904.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 3359737..3359825 | + | 89 | - | - | Antitoxin |
- | 3359739..3359834 | - | 96 | - | - | Toxin |
KGP17_RS15535 (KGP17_15470) | 3359975..3360316 | - | 342 | WP_021806756.1 | YebY family protein | - |
KGP17_RS15540 (KGP17_15475) | 3360386..3361267 | - | 882 | WP_223497905.1 | copper homeostasis membrane protein CopD | - |
KGP17_RS15545 (KGP17_15480) | 3361271..3361654 | - | 384 | WP_223497906.1 | CopC domain-containing protein YobA | - |
KGP17_RS15550 (KGP17_15485) | 3361978..3362496 | - | 519 | WP_021806759.1 | non-heme ferritin | - |
KGP17_RS15555 (KGP17_15490) | 3362883..3363113 | + | 231 | WP_209526777.1 | DNA polymerase III subunit theta | - |
KGP17_RS15560 (KGP17_15495) | 3363439..3364428 | - | 990 | WP_121607109.1 | prolyl aminopeptidase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 3273429..3370433 | 97004 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 96 bp
>T201640 NZ_CP074147:c3359834-3359739 [Serratia sp. JSRIV001]
AACAAACCTTGCATAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCCTTTCCCTAGACCGAGTATAGGAATCG
TACTCGGTCTTTTTTT
AACAAACCTTGCATAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCCTTTCCCTAGACCGAGTATAGGAATCG
TACTCGGTCTTTTTTT
Antitoxin
Download Length: 89 bp
>AT201640 NZ_CP074147:3359737-3359825 [Serratia sp. JSRIV001]
ATAAAAAAAGACCGAGTACGATTCCTATACTCGGTCTAGGGAAAGGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTTATGCA
ATAAAAAAAGACCGAGTACGATTCCTATACTCGGTCTAGGGAAAGGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTTATGCA