Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3512775..3512872 | Replicon | chromosome |
Accession | NZ_CP074143 | ||
Organism | Serratia sp. JSRIV002 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3512777..3512872 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3512775..3512863 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KGP26_RS16475 (KGP26_16415) | 3507946..3508488 | - | 543 | WP_059201044.1 | hypothetical protein | - |
KGP26_RS16480 (KGP26_16420) | 3508916..3510187 | - | 1272 | WP_021806748.1 | translesion error-prone DNA polymerase V subunit UmuC | - |
KGP26_RS16485 (KGP26_16425) | 3510187..3510609 | - | 423 | WP_021806749.1 | translesion error-prone DNA polymerase V autoproteolytic subunit | - |
KGP26_RS16490 (KGP26_16430) | 3510829..3511314 | - | 486 | WP_223499939.1 | anti-virulence regulator CigR family protein | - |
KGP26_RS16495 (KGP26_16435) | 3511625..3512497 | - | 873 | WP_223535717.1 | excinuclease Cho | - |
- | 3512775..3512863 | + | 89 | - | - | Antitoxin |
- | 3512777..3512872 | - | 96 | - | - | Toxin |
KGP26_RS16500 (KGP26_16440) | 3513013..3513354 | - | 342 | WP_021806756.1 | YebY family protein | - |
KGP26_RS16505 (KGP26_16445) | 3513424..3514305 | - | 882 | WP_218519230.1 | copper homeostasis membrane protein CopD | - |
KGP26_RS16510 (KGP26_16450) | 3514309..3514692 | - | 384 | WP_024485865.1 | CopC domain-containing protein YobA | - |
KGP26_RS16515 (KGP26_16455) | 3515015..3515533 | - | 519 | WP_021806759.1 | non-heme ferritin | - |
KGP26_RS16520 (KGP26_16460) | 3515922..3516152 | + | 231 | WP_021181054.1 | DNA polymerase III subunit theta | - |
KGP26_RS16525 (KGP26_16465) | 3516160..3517385 | - | 1226 | Protein_3236 | IS481 family transposase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | chuW / chuY | 3480765..3527503 | 46738 | |
- | flank | IS/Tn | - | - | 3516231..3517373 | 1142 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 96 bp
>T201615 NZ_CP074143:c3512872-3512777 [Serratia sp. JSRIV002]
AACAAACCTTGCATAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCCTTTCCCTAGACCGAGTATAGGAATCG
TACTCGGTCTTTTTTT
AACAAACCTTGCATAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCCTTTCCCTAGACCGAGTATAGGAATCG
TACTCGGTCTTTTTTT
Antitoxin
Download Length: 89 bp
>AT201615 NZ_CP074143:3512775-3512863 [Serratia sp. JSRIV002]
ATAAAAAAAGACCGAGTACGATTCCTATACTCGGTCTAGGGAAAGGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTTATGCA
ATAAAAAAAGACCGAGTACGATTCCTATACTCGGTCTAGGGAAAGGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTTATGCA