Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2069545..2069690 | Replicon | chromosome |
Accession | NZ_CP074116 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain kpn-hnqyy |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2069581..2069683 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2069545..2069690 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KGB32_RS10195 (KGB32_10195) | 2064675..2066735 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
KGB32_RS10200 (KGB32_10200) | 2066739..2067398 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
KGB32_RS10205 (KGB32_10205) | 2067477..2067707 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
KGB32_RS10210 (KGB32_10210) | 2067820..2068194 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
KGB32_RS10215 (KGB32_10215) | 2068198..2069067 | + | 870 | WP_062955019.1 | copper homeostasis membrane protein CopD | - |
KGB32_RS10220 (KGB32_10220) | 2069084..2069422 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2069545..2069690 | - | 146 | - | - | Antitoxin |
- | 2069581..2069683 | + | 103 | - | - | Toxin |
KGB32_RS10225 (KGB32_10225) | 2070058..2070201 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
KGB32_RS10230 (KGB32_10230) | 2070306..2071274 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
KGB32_RS10235 (KGB32_10235) | 2071431..2072084 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
KGB32_RS10240 (KGB32_10240) | 2072081..2072272 | - | 192 | WP_002911395.1 | YebW family protein | - |
KGB32_RS10245 (KGB32_10245) | 2072370..2072609 | - | 240 | WP_002911393.1 | YebV family protein | - |
KGB32_RS10250 (KGB32_10250) | 2072725..2074158 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T201478 NZ_CP074116:2069581-2069683 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT201478 NZ_CP074116:c2069690-2069545 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT