Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2082062..2082207 | Replicon | chromosome |
Accession | NZ_CP073285 | ||
Organism | Klebsiella pneumoniae subsp. ozaenae strain WCHKP030925 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2082098..2082200 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2082062..2082207 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
CLQ62_RS10020 | 2077192..2079252 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
CLQ62_RS10025 | 2079256..2079915 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
CLQ62_RS10030 | 2079994..2080224 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
CLQ62_RS10035 | 2080337..2080711 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
CLQ62_RS10040 | 2080715..2081584 | + | 870 | WP_014907333.1 | copper homeostasis membrane protein CopD | - |
CLQ62_RS10045 | 2081601..2081939 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2082062..2082207 | - | 146 | - | - | Antitoxin |
- | 2082098..2082200 | + | 103 | - | - | Toxin |
CLQ62_RS10050 | 2082575..2082718 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
CLQ62_RS10055 | 2082823..2083791 | - | 969 | WP_014907334.1 | VirK/YbjX family protein | - |
CLQ62_RS10060 | 2083948..2084601 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
CLQ62_RS10065 | 2084598..2084789 | - | 192 | WP_002911395.1 | YebW family protein | - |
CLQ62_RS10070 | 2084887..2085126 | - | 240 | WP_002911393.1 | YebV family protein | - |
CLQ62_RS10075 | 2085242..2086675 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T199650 NZ_CP073285:2082098-2082200 [Klebsiella pneumoniae subsp. ozaenae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT199650 NZ_CP073285:c2082207-2082062 [Klebsiella pneumoniae subsp. ozaenae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT