Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1991238..1991383 | Replicon | chromosome |
Accession | NZ_CP072949 | ||
Organism | Klebsiella pneumoniae MGH 39 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1991274..1991376 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1991238..1991383 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
IBD60_RS09585 | 1986368..1988428 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
IBD60_RS09590 | 1988432..1989091 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
IBD60_RS09595 | 1989170..1989400 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
IBD60_RS09600 | 1989513..1989887 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
IBD60_RS09605 | 1989891..1990760 | + | 870 | WP_004189267.1 | copper homeostasis membrane protein CopD | - |
IBD60_RS09610 | 1990777..1991115 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1991238..1991383 | - | 146 | - | - | Antitoxin |
- | 1991274..1991376 | + | 103 | - | - | Toxin |
IBD60_RS09615 | 1991751..1991894 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
IBD60_RS09620 | 1991999..1992967 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
IBD60_RS09625 | 1993124..1993777 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
IBD60_RS09630 | 1993774..1993965 | - | 192 | WP_002911395.1 | YebW family protein | - |
IBD60_RS09635 | 1994063..1994302 | - | 240 | WP_002911393.1 | YebV family protein | - |
IBD60_RS09640 | 1994418..1995851 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T199259 NZ_CP072949:1991274-1991376 [Klebsiella pneumoniae MGH 39]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT199259 NZ_CP072949:c1991383-1991238 [Klebsiella pneumoniae MGH 39]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT