Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1981261..1981406 | Replicon | chromosome |
Accession | NZ_CP071819 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain 90CM2 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1981297..1981399 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1981261..1981406 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
IM758_RS09640 | 1976391..1978451 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
IM758_RS09645 | 1978455..1979114 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
IM758_RS09650 | 1979193..1979423 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
IM758_RS09655 | 1979536..1979910 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
IM758_RS09660 | 1979914..1980783 | + | 870 | WP_004189267.1 | copper homeostasis membrane protein CopD | - |
IM758_RS09665 | 1980800..1981138 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1981261..1981406 | - | 146 | - | - | Antitoxin |
- | 1981297..1981399 | + | 103 | - | - | Toxin |
IM758_RS09670 | 1981774..1981917 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
IM758_RS09675 | 1982022..1982990 | - | 969 | WP_074442383.1 | VirK/YbjX family protein | - |
IM758_RS09680 | 1983147..1983800 | + | 654 | WP_024622748.1 | protein-serine/threonine phosphatase | - |
IM758_RS09685 | 1983797..1983988 | - | 192 | WP_002911395.1 | YebW family protein | - |
IM758_RS09690 | 1984086..1984325 | - | 240 | WP_002911393.1 | YebV family protein | - |
IM758_RS09695 | 1984441..1985874 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T196983 NZ_CP071819:1981297-1981399 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT196983 NZ_CP071819:c1981406-1981261 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT