Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1698331..1698476 | Replicon | chromosome |
Accession | NZ_CP071279 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain SA-KpST14 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1698367..1698469 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1698331..1698476 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
JZ794_RS08360 | 1693461..1695521 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
JZ794_RS08365 | 1695525..1696184 | - | 660 | WP_043906809.1 | exodeoxyribonuclease X | - |
JZ794_RS08370 | 1696263..1696493 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
JZ794_RS08375 | 1696606..1696980 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
JZ794_RS08380 | 1696984..1697853 | + | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
JZ794_RS08385 | 1697870..1698208 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1698331..1698476 | - | 146 | - | - | Antitoxin |
- | 1698367..1698469 | + | 103 | - | - | Toxin |
JZ794_RS08390 | 1698845..1698988 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
JZ794_RS08395 | 1699093..1700061 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
JZ794_RS08400 | 1700218..1700871 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
JZ794_RS08405 | 1700868..1701059 | - | 192 | WP_002911395.1 | YebW family protein | - |
JZ794_RS08410 | 1701157..1701396 | - | 240 | WP_002911393.1 | YebV family protein | - |
JZ794_RS08415 | 1701512..1702945 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T196139 NZ_CP071279:1698367-1698469 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT196139 NZ_CP071279:c1698476-1698331 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT