Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2039656..2039796 | Replicon | chromosome |
Accession | NZ_CP071196 | ||
Organism | Serratia marcescens subsp. marcescens ATCC 13880 substr. Sm_S54_jyu2015 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2039700..2039796 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2039656..2039796 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
J0G03_RS09740 | 2034924..2035319 | + | 396 | WP_033640666.1 | RidA family protein | - |
J0G03_RS09745 | 2035476..2036429 | + | 954 | WP_033641435.1 | prolyl aminopeptidase | - |
J0G03_RS09750 | 2036461..2036691 | - | 231 | WP_016928156.1 | DNA polymerase III subunit theta | - |
J0G03_RS09755 | 2037036..2037554 | + | 519 | WP_015377481.1 | non-heme ferritin | - |
J0G03_RS09760 | 2037847..2038263 | + | 417 | WP_042706245.1 | CopC domain-containing protein YobA | - |
J0G03_RS09765 | 2038266..2039147 | + | 882 | WP_033640664.1 | copper homeostasis membrane protein CopD | - |
J0G03_RS09770 | 2039217..2039558 | + | 342 | WP_004940890.1 | YebY family protein | - |
- | 2039656..2039796 | - | 141 | - | - | Antitoxin |
- | 2039700..2039796 | + | 97 | - | - | Toxin |
J0G03_RS09775 | 2040048..2040452 | + | 405 | WP_033640663.1 | hypothetical protein | - |
J0G03_RS09780 | 2040449..2040667 | - | 219 | WP_033640661.1 | hypothetical protein | - |
J0G03_RS09785 | 2040742..2041092 | - | 351 | WP_033640660.1 | hypothetical protein | - |
J0G03_RS09790 | 2041341..2041691 | + | 351 | WP_033640658.1 | DUF4377 domain-containing protein | - |
J0G03_RS09795 | 2041875..2043074 | + | 1200 | WP_016928134.1 | trans-2-enoyl-CoA reductase family protein | - |
J0G03_RS09800 | 2043301..2043519 | + | 219 | WP_033640657.1 | hypothetical protein | - |
J0G03_RS09805 | 2043691..2043996 | + | 306 | WP_016928132.1 | hypothetical protein | - |
J0G03_RS09810 | 2044045..2044380 | + | 336 | WP_016928131.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T195600 NZ_CP071196:2039700-2039796 [Serratia marcescens subsp. marcescens ATCC 13880]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT195600 NZ_CP071196:c2039796-2039656 [Serratia marcescens subsp. marcescens ATCC 13880]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG