Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2070921..2071066 | Replicon | chromosome |
Accession | NZ_CP068689 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain RJBSI76 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2070957..2071059 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2070921..2071066 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
I5002_RS10120 | 2066051..2068111 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
I5002_RS10125 | 2068115..2068774 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
I5002_RS10130 | 2068853..2069083 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
I5002_RS10135 | 2069196..2069570 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
I5002_RS10140 | 2069574..2070443 | + | 870 | WP_062955019.1 | copper homeostasis membrane protein CopD | - |
I5002_RS10145 | 2070460..2070798 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2070921..2071066 | - | 146 | - | - | Antitoxin |
- | 2070957..2071059 | + | 103 | - | - | Toxin |
I5002_RS10150 | 2071434..2071577 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
I5002_RS10155 | 2071682..2072650 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
I5002_RS10160 | 2072807..2073460 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
I5002_RS10165 | 2073457..2073648 | - | 192 | WP_002911395.1 | YebW family protein | - |
I5002_RS10170 | 2073746..2073985 | - | 240 | WP_002911393.1 | YebV family protein | - |
I5002_RS10175 | 2074101..2075534 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T187568 NZ_CP068689:2070957-2071059 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT187568 NZ_CP068689:c2071066-2070921 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT