Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3335679..3335824 | Replicon | chromosome |
Accession | NZ_CP068684 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain RJBSI76-pV |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3335686..3335788 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3335679..3335824 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
JMY88_RS16495 | 3331211..3332644 | + | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
JMY88_RS16500 | 3332760..3332999 | + | 240 | WP_002911393.1 | YebV family protein | - |
JMY88_RS16505 | 3333097..3333288 | + | 192 | WP_002911395.1 | YebW family protein | - |
JMY88_RS16510 | 3333285..3333938 | - | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
JMY88_RS16515 | 3334095..3335063 | + | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
JMY88_RS16520 | 3335168..3335311 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
- | 3335679..3335824 | + | 146 | - | - | Antitoxin |
- | 3335686..3335788 | - | 103 | - | - | Toxin |
JMY88_RS16525 | 3335947..3336285 | - | 339 | WP_002911404.1 | YebY family protein | - |
JMY88_RS16530 | 3336302..3337171 | - | 870 | WP_062955019.1 | copper homeostasis membrane protein CopD | - |
JMY88_RS16535 | 3337175..3337549 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
JMY88_RS16540 | 3337662..3337892 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
JMY88_RS16545 | 3337971..3338630 | + | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
JMY88_RS16550 | 3338634..3340694 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T187534 NZ_CP068684:c3335788-3335686 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT187534 NZ_CP068684:3335679-3335824 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT