Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2882635..2882778 | Replicon | chromosome |
| Accession | NZ_CP066851 | ||
| Organism | Salmonella enterica subsp. enterica serovar Heidelberg strain SH-2813-Parental | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2882637..2882740 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2882635..2882778 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| JIG31_RS13980 | 2877764..2877964 | + | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
| JIG31_RS13985 | 2878061..2878572 | - | 512 | Protein_2754 | tail fiber assembly protein | - |
| JIG31_RS13990 | 2878585..2878872 | - | 288 | Protein_2755 | macro domain-containing protein | - |
| JIG31_RS13995 | 2879099..2879359 | - | 261 | Protein_2756 | DUF1441 family protein | - |
| JIG31_RS14000 | 2879667..2879834 | + | 168 | WP_000789529.1 | lytic enzyme | - |
| JIG31_RS14005 | 2880091..2880624 | - | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
| JIG31_RS14010 | 2880678..2880869 | - | 192 | Protein_2759 | glycoside hydrolase family 19 protein | - |
| JIG31_RS23305 | 2880858..2881319 | + | 462 | Protein_2760 | DNA breaking-rejoining protein | - |
| JIG31_RS14020 | 2881583..2882506 | + | 924 | Protein_2761 | tyrosine-type recombinase/integrase | - |
| - | 2882635..2882778 | + | 144 | - | - | Antitoxin |
| - | 2882637..2882740 | - | 104 | - | - | Toxin |
| JIG31_RS14025 | 2882880..2883233 | - | 354 | WP_000722368.1 | YebY family protein | - |
| JIG31_RS14030 | 2883250..2884125 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| JIG31_RS14035 | 2884126..2884500 | - | 375 | WP_000168394.1 | CopC domain-containing protein YobA | - |
| JIG31_RS14040 | 2884638..2884868 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| JIG31_RS14045 | 2884976..2885632 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| JIG31_RS14050 | 2885656..2886354 | + | 699 | WP_000944284.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2850117..2904648 | 54531 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T185238 NZ_CP066851:c2882740-2882637 [Salmonella enterica subsp. enterica serovar Heidelberg]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT185238 NZ_CP066851:2882635-2882778 [Salmonella enterica subsp. enterica serovar Heidelberg]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
