Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2649660..2649805 | Replicon | chromosome |
Accession | NZ_CP066143 | ||
Organism | Klebsiella pneumoniae U-0608239 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2649667..2649769 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2649660..2649805 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
I6N99_RS13225 | 2645191..2646624 | + | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
I6N99_RS13230 | 2646740..2646979 | + | 240 | WP_002911393.1 | YebV family protein | - |
I6N99_RS13235 | 2647077..2647268 | + | 192 | WP_002911395.1 | YebW family protein | - |
I6N99_RS13240 | 2647265..2647918 | - | 654 | WP_009307541.1 | protein-serine/threonine phosphatase | - |
I6N99_RS13245 | 2648075..2649043 | + | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
I6N99_RS13250 | 2649148..2649291 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
- | 2649660..2649805 | + | 146 | - | - | Antitoxin |
- | 2649667..2649769 | - | 103 | - | - | Toxin |
I6N99_RS13255 | 2649928..2650266 | - | 339 | WP_009307539.1 | YebY family protein | - |
I6N99_RS13260 | 2650283..2651152 | - | 870 | WP_009307538.1 | copper homeostasis membrane protein CopD | - |
I6N99_RS13265 | 2651156..2651530 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
I6N99_RS13270 | 2651643..2651873 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
I6N99_RS13275 | 2651952..2652611 | + | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
I6N99_RS13280 | 2652615..2654675 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T184040 NZ_CP066143:c2649769-2649667 [Klebsiella pneumoniae U-0608239]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT184040 NZ_CP066143:2649660-2649805 [Klebsiella pneumoniae U-0608239]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT