Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3490886..3491028 | Replicon | chromosome |
Accession | NZ_CP065747 | ||
Organism | Serratia plymuthica strain FDAARGOS_896 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3490888..3490984 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3490886..3491028 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
I6G53_RS16080 | 3486267..3487005 | + | 739 | Protein_3160 | alpha/beta hydrolase | - |
I6G53_RS16085 | 3487266..3487418 | - | 153 | WP_197931110.1 | hypothetical protein | - |
I6G53_RS16090 | 3487544..3487657 | - | 114 | Protein_3162 | IS1 family transposase | - |
I6G53_RS16095 | 3487872..3488288 | + | 417 | Protein_3163 | TonB-dependent receptor plug domain-containing protein | - |
I6G53_RS16100 | 3488598..3489677 | + | 1080 | WP_197927543.1 | acyltransferase | - |
I6G53_RS16105 | 3489699..3489971 | - | 273 | WP_197927545.1 | hypothetical protein | - |
I6G53_RS16110 | 3489960..3490830 | + | 871 | Protein_3166 | tyrosine-type recombinase/integrase | - |
- | 3490886..3491028 | + | 143 | - | - | Antitoxin |
- | 3490888..3490984 | - | 97 | - | - | Toxin |
I6G53_RS16115 | 3491126..3491467 | - | 342 | WP_004943126.1 | YebY family protein | - |
I6G53_RS16120 | 3491537..3492418 | - | 882 | WP_197927547.1 | copper homeostasis membrane protein CopD | - |
I6G53_RS16125 | 3492422..3492805 | - | 384 | WP_013812465.1 | CopC domain-containing protein YobA | - |
I6G53_RS16130 | 3493110..3493628 | - | 519 | WP_197927549.1 | non-heme ferritin | - |
I6G53_RS16135 | 3494003..3494233 | + | 231 | WP_063197859.1 | DNA polymerase III subunit theta | - |
I6G53_RS16140 | 3494262..3495215 | - | 954 | WP_197927552.1 | prolyl aminopeptidase | - |
I6G53_RS16145 | 3495384..3495809 | - | 426 | WP_197927554.1 | TraR/DksA C4-type zinc finger protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T183300 NZ_CP065747:c3490984-3490888 [Serratia plymuthica]
AACAAGCCCTGCACAAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCACAAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 143 bp
>AT183300 NZ_CP065747:3490886-3491028 [Serratia plymuthica]
ATAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTTTGTGCAGGGCTTGTTCAGCCATGCACTTTAAGAGTAGCTTACCGCGCTAGTTTTGCCAG
ATAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTTTGTGCAGGGCTTGTTCAGCCATGCACTTTAAGAGTAGCTTACCGCGCTAGTTTTGCCAG