Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2777769..2777911 | Replicon | chromosome |
Accession | NZ_CP065693 | ||
Organism | Enterobacter asburiae strain FDAARGOS_892 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2777804..2777907 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2777769..2777911 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
I6G49_RS13840 | 2774254..2774916 | - | 663 | WP_010432611.1 | exodeoxyribonuclease X | - |
I6G49_RS13845 | 2774941..2775591 | - | 651 | WP_059346946.1 | carbon-nitrogen hydrolase family protein | - |
I6G49_RS13850 | 2775701..2775931 | - | 231 | WP_013096102.1 | DNA polymerase III subunit theta | - |
I6G49_RS13855 | 2776068..2776439 | + | 372 | WP_054829619.1 | CopC domain-containing protein YobA | - |
I6G49_RS13860 | 2776441..2777310 | + | 870 | WP_059346945.1 | copper homeostasis membrane protein CopD | - |
I6G49_RS13865 | 2777327..2777665 | + | 339 | WP_045404471.1 | YebY family protein | - |
- | 2777769..2777911 | - | 143 | - | - | Antitoxin |
- | 2777804..2777907 | + | 104 | - | - | Toxin |
I6G49_RS13870 | 2778040..2779119 | - | 1080 | WP_059346944.1 | phage integrase Arm DNA-binding domain-containing protein | - |
I6G49_RS13875 | 2779097..2779357 | - | 261 | WP_054829630.1 | hypothetical protein | - |
I6G49_RS13880 | 2779414..2779656 | - | 243 | WP_054829618.1 | DUF4060 family protein | - |
I6G49_RS13885 | 2779643..2779936 | - | 294 | WP_054829617.1 | hypothetical protein | - |
I6G49_RS13890 | 2779933..2781828 | - | 1896 | WP_059346943.1 | hypothetical protein | - |
I6G49_RS13895 | 2782051..2782323 | - | 273 | WP_059346942.1 | hypothetical protein | - |
I6G49_RS13900 | 2782393..2782578 | - | 186 | WP_153251268.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2772197..2835734 | 63537 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T183207 NZ_CP065693:2777804-2777907 [Enterobacter asburiae]
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 143 bp
>AT183207 NZ_CP065693:c2777911-2777769 [Enterobacter asburiae]
AGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT
AGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT