Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2014701..2014846 | Replicon | chromosome |
Accession | NZ_CP065554 | ||
Organism | Klebsiella pneumoniae strain FK 6768 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2014737..2014839 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2014701..2014846 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
I7S93_RS09855 (I7S93_09855) | 2009831..2011891 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
I7S93_RS09860 (I7S93_09860) | 2011895..2012554 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
I7S93_RS09865 (I7S93_09865) | 2012633..2012863 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
I7S93_RS09870 (I7S93_09870) | 2012976..2013350 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
I7S93_RS09875 (I7S93_09875) | 2013354..2014223 | + | 870 | WP_062955019.1 | copper homeostasis membrane protein CopD | - |
I7S93_RS09880 (I7S93_09880) | 2014240..2014578 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2014701..2014846 | - | 146 | - | - | Antitoxin |
- | 2014737..2014839 | + | 103 | - | - | Toxin |
I7S93_RS09885 (I7S93_09885) | 2015214..2015357 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
I7S93_RS09890 (I7S93_09890) | 2015462..2016430 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
I7S93_RS09895 (I7S93_09895) | 2016587..2017240 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
I7S93_RS09900 (I7S93_09900) | 2017237..2017428 | - | 192 | WP_002911395.1 | YebW family protein | - |
I7S93_RS09905 (I7S93_09905) | 2017526..2017765 | - | 240 | WP_002911393.1 | YebV family protein | - |
I7S93_RS09910 (I7S93_09910) | 2017881..2019314 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T182906 NZ_CP065554:2014737-2014839 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT182906 NZ_CP065554:c2014846-2014701 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT