Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 651016..651163 | Replicon | chromosome |
Accession | NZ_CP065467 | ||
Organism | Klebsiella quasipneumoniae strain Pinhead Larry |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 651057..651159 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 651016..651163 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
I5M56_RS03065 | 646151..648211 | + | 2061 | WP_194425788.1 | oligopeptidase B | - |
I5M56_RS03070 | 648215..648874 | - | 660 | WP_004203387.1 | exodeoxyribonuclease X | - |
I5M56_RS03075 | 648953..649183 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
I5M56_RS03080 | 649296..649670 | + | 375 | WP_108450984.1 | CopC domain-containing protein YobA | - |
I5M56_RS03085 | 649674..650543 | + | 870 | WP_004203385.1 | copper homeostasis membrane protein CopD | - |
I5M56_RS03090 | 650560..650898 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 651016..651163 | - | 148 | - | - | Antitoxin |
- | 651057..651159 | + | 103 | - | - | Toxin |
I5M56_RS03095 | 651547..651690 | - | 144 | WP_032425946.1 | Ecr family regulatory small membrane protein | - |
I5M56_RS03100 | 651794..652762 | - | 969 | WP_151628733.1 | VirK/YbjX family protein | - |
I5M56_RS03105 | 652919..653572 | + | 654 | WP_004203382.1 | protein-serine/threonine phosphatase | - |
I5M56_RS03110 | 653569..653760 | - | 192 | WP_002911395.1 | YebW family protein | - |
I5M56_RS03115 | 653858..654097 | - | 240 | WP_002911393.1 | YebV family protein | - |
I5M56_RS03120 | 654214..655647 | - | 1434 | WP_108450985.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T182813 NZ_CP065467:651057-651159 [Klebsiella quasipneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 148 bp
>AT182813 NZ_CP065467:c651163-651016 [Klebsiella quasipneumoniae]
AGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGTCTGCG
AGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGTCTGCG