Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 666411..666556 | Replicon | chromosome |
Accession | NZ_CP065453 | ||
Organism | Klebsiella pneumoniae strain Beach Ranger |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 666418..666520 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 666411..666556 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
I5M60_RS03365 | 661943..663376 | + | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
I5M60_RS03370 | 663492..663731 | + | 240 | WP_002911393.1 | YebV family protein | - |
I5M60_RS03375 | 663829..664020 | + | 192 | WP_002911395.1 | YebW family protein | - |
I5M60_RS03380 | 664017..664670 | - | 654 | WP_024622748.1 | protein-serine/threonine phosphatase | - |
I5M60_RS03385 | 664827..665795 | + | 969 | WP_014907334.1 | VirK/YbjX family protein | - |
I5M60_RS03390 | 665900..666043 | + | 144 | WP_038431282.1 | Ecr family regulatory small membrane protein | - |
- | 666411..666556 | + | 146 | - | - | Antitoxin |
- | 666418..666520 | - | 103 | - | - | Toxin |
I5M60_RS03395 | 666679..667017 | - | 339 | WP_002911404.1 | YebY family protein | - |
I5M60_RS03400 | 667034..667903 | - | 870 | WP_004175431.1 | copper homeostasis membrane protein CopD | - |
I5M60_RS03405 | 667907..668281 | - | 375 | WP_039819395.1 | CopC domain-containing protein YobA | - |
I5M60_RS03410 | 668394..668624 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
I5M60_RS03415 | 668703..669362 | + | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
I5M60_RS03420 | 669366..671426 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T182723 NZ_CP065453:c666520-666418 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT182723 NZ_CP065453:666411-666556 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT