Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 677875..678020 | Replicon | chromosome |
Accession | NZ_CP065447 | ||
Organism | Klebsiella pneumoniae strain Ocean Ranger |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 677911..678013 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 677875..678020 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
I5M61_RS03150 | 673005..675065 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
I5M61_RS03155 | 675069..675728 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
I5M61_RS03160 | 675807..676037 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
I5M61_RS03165 | 676150..676524 | + | 375 | WP_039819395.1 | CopC domain-containing protein YobA | - |
I5M61_RS03170 | 676528..677397 | + | 870 | WP_004175431.1 | copper homeostasis membrane protein CopD | - |
I5M61_RS03175 | 677414..677752 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 677875..678020 | - | 146 | - | - | Antitoxin |
- | 677911..678013 | + | 103 | - | - | Toxin |
I5M61_RS03180 | 678388..678531 | - | 144 | WP_038431282.1 | Ecr family regulatory small membrane protein | - |
I5M61_RS03185 | 678636..679604 | - | 969 | WP_014907334.1 | VirK/YbjX family protein | - |
I5M61_RS03190 | 679761..680414 | + | 654 | WP_024622748.1 | protein-serine/threonine phosphatase | - |
I5M61_RS03195 | 680411..680602 | - | 192 | WP_002911395.1 | YebW family protein | - |
I5M61_RS03200 | 680700..680939 | - | 240 | WP_002911393.1 | YebV family protein | - |
I5M61_RS03205 | 681055..682488 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T182703 NZ_CP065447:677911-678013 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT182703 NZ_CP065447:c678020-677875 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT