Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3915131..3915276 | Replicon | chromosome |
Accession | NZ_CP065438 | ||
Organism | Klebsiella pneumoniae strain Mrs. Puff |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3915138..3915240 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3915131..3915276 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
I5M55_RS19225 | 3910663..3912096 | + | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
I5M55_RS19230 | 3912212..3912451 | + | 240 | WP_002911393.1 | YebV family protein | - |
I5M55_RS19235 | 3912549..3912740 | + | 192 | WP_002911395.1 | YebW family protein | - |
I5M55_RS19240 | 3912737..3913390 | - | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
I5M55_RS19245 | 3913547..3914515 | + | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
I5M55_RS19250 | 3914620..3914763 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
- | 3915131..3915276 | + | 146 | - | - | Antitoxin |
- | 3915138..3915240 | - | 103 | - | - | Toxin |
I5M55_RS19255 | 3915399..3915737 | - | 339 | WP_002911404.1 | YebY family protein | - |
I5M55_RS19260 | 3915754..3916623 | - | 870 | WP_062955019.1 | copper homeostasis membrane protein CopD | - |
I5M55_RS19265 | 3916627..3917001 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
I5M55_RS19270 | 3917114..3917344 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
I5M55_RS19275 | 3917423..3918082 | + | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
I5M55_RS19280 | 3918086..3920146 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T182644 NZ_CP065438:c3915240-3915138 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT182644 NZ_CP065438:3915131-3915276 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT