Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 666712..666857 | Replicon | chromosome |
Accession | NZ_CP065436 | ||
Organism | Klebsiella pneumoniae strain Dirty Dan |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 666748..666850 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 666712..666857 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
I6Z21_RS03160 | 661842..663902 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
I6Z21_RS03165 | 663906..664565 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
I6Z21_RS03170 | 664644..664874 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
I6Z21_RS03175 | 664987..665361 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
I6Z21_RS03180 | 665365..666234 | + | 870 | WP_004891049.1 | copper homeostasis membrane protein CopD | - |
I6Z21_RS03185 | 666251..666589 | + | 339 | WP_016529031.1 | YebY family protein | - |
- | 666712..666857 | - | 146 | - | - | Antitoxin |
- | 666748..666850 | + | 103 | - | - | Toxin |
I6Z21_RS03190 | 667225..667368 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
I6Z21_RS03195 | 667473..668441 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
I6Z21_RS03200 | 668598..669251 | + | 654 | WP_009307541.1 | protein-serine/threonine phosphatase | - |
I6Z21_RS03205 | 669248..669439 | - | 192 | WP_002911395.1 | YebW family protein | - |
I6Z21_RS03210 | 669537..669776 | - | 240 | WP_002911393.1 | YebV family protein | - |
I6Z21_RS03215 | 669892..671325 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T182616 NZ_CP065436:666748-666850 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT182616 NZ_CP065436:c666857-666712 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT