Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1931029..1931174 | Replicon | chromosome |
Accession | NZ_CP065341 | ||
Organism | Klebsiella pneumoniae strain ZG2017CW 1-1-1 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1931065..1931167 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1931029..1931174 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
I5Q76_RS09355 | 1926159..1928219 | + | 2061 | WP_047694778.1 | oligopeptidase B | - |
I5Q76_RS09360 | 1928223..1928882 | - | 660 | WP_102000926.1 | exodeoxyribonuclease X | - |
I5Q76_RS09365 | 1928961..1929191 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
I5Q76_RS09370 | 1929304..1929678 | + | 375 | WP_023285314.1 | CopC domain-containing protein YobA | - |
I5Q76_RS09375 | 1929682..1930551 | + | 870 | WP_023285313.1 | copper homeostasis membrane protein CopD | - |
I5Q76_RS09380 | 1930568..1930906 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1931029..1931174 | - | 146 | - | - | Antitoxin |
- | 1931065..1931167 | + | 103 | - | - | Toxin |
I5Q76_RS09385 | 1931542..1931685 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
I5Q76_RS09390 | 1931790..1932758 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
I5Q76_RS09395 | 1932915..1933568 | + | 654 | WP_023280291.1 | protein-serine/threonine phosphatase | - |
I5Q76_RS09400 | 1933565..1933756 | - | 192 | WP_002911395.1 | YebW family protein | - |
I5Q76_RS09405 | 1933854..1934093 | - | 240 | WP_002911393.1 | YebV family protein | - |
I5Q76_RS09410 | 1934209..1935642 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T182372 NZ_CP065341:1931065-1931167 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT182372 NZ_CP065341:c1931174-1931029 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT